Knockout Cell Lines

Generation of knockout (KO) cell line models with a loss-of-function mutation is an important method for studying the function of given genes. Compared with traditional gene interference (RNAi) technology, gene knockout (KO) models allow researchers to fully disrupt expression of the target gene, ultimately leading to either complete non-expression or loss of function in proteins. Gene knockout (KO) cell lines enable researchers to study the role of specific genes by comparing the phenotypic differences among the knockout and wildtype cells.

The generation of gene knockout cell lines can be time-consuming and complicated, especially for researchers unfamiliar with the process. Oftentimes, scientists may spend 3-4 months attempting to generate a custom cell line, but end up with an incomplete knockout upon genotyping – significantly setting back research progress.

Cyagen Knockout Cell Line Service

Cyagen’s Smart-CRISPR™ cell line modeling services enable large fragment excision or accurate mutation(s) – providing knockout cell lines with complete loss-of-function of the target gene.

Our custom cell line modeling services platform features CRISPR-mediated gene editing that is optimally targeted with our proprietary artificial intelligence (AI)-based AlphaKnockout Smart Gene Targeting System - enabling higher knockout (KO) efficiency. We can perform multiple knockout strategies, including frameshift mutation, large fragment knockout, and multiple genes knockout. With CRISPR-Pro technology, researchers can easily solve the problem of residual protein expression seen in RNA interference (RNAi) gene knockdown models.

Our experts have generated 1,000+ cell line models - Cyagen can rapidly generate knockout cell lines for your research using our highly efficient Smart-CRISPR™ platform.

Highlight Features

Knockout Modification Strategies

We can perform a variety of knockout (KO) strategies to generate a custom cell line model, including frameshift mutation, large fragment knockout, and multiple genes knockout. We will adopt the best knockout strategy to greatly improve the success rate of target gene knockout and the expression efficiency according to each project's unique requirements.

Short Timeline

The unique combination of our highly efficient CRISPR-based technology platform along with extensive experience allows for rapid knockout cell line model generation, up to 2-3 weeks shorter than the conventional timeline.

Customized Deliverables

Upon request, we can deliver homozygous, heterozygous, or negative clones. We can additionally provide professional experiment reports and quality inspection reports.

Cyagen Cell Line Generation Platform Advantages

• Efficient Smart-CRISPR Technology: Allows for multiple knock-out strategies, higher gene editing efficiency, and ensuring protein complete non-expression to the greatest extent.
• Superior Customer Support: VIP project specialist is available for project follow-up and progress reporting support.
• Quality Control: Thorough validation and testing are performed to ensure that the cell line model meets your requirements.
• Extensive Experience: Over 1,000 cell models successfully generated, receiving over 100 peer-reviewed citations thus far.
• One-stop Solution: Cyagen offers comprehensive solutions for both in vivo and in vitro studies, from gene expression regulation and gene function verification across various cells, to establishment of mouse or rat models, as well as downstream phenotypic analysis.

Featured Cell Lines （Successfully Generated）

Successful Case Study - Knockout Cell Line

Project: Human HCT116 cell PSME3 gene knockout (fragment deletion)

1. gRNA Design

gRNA Site 1: ATACGCTACCTAACATGGCTGGG；

gRNA Site 2: CCAGCATGCAAAATACAATGGGG

2. Primer Synthesis and Plasmid Construction

3. Cell Transfection

Firstly, confirm the optimal electroporation parameters, then transfect the vector into cells by electroporation.

4. Single Cell Clone Screening and Culture

5. PCR and Electrophoresis Identification

Identification Strategy:

6. Sequencing Identification

ATAAACAGAGGATTTAAGACTTTTGTTATGTTTTAGACGC-del；

1809bp--AGTGGCTAATGCCT GTAATCC CACCACTTTGGGAGGCCAA