Point Mutation Cell Lines
Locate My Expert
Point mutation defined as one or more nucleotides are mutated. The insertion, deletion, nonsense and sense mutations alter the amino acid sequence, thus changing its functions or properties of a given protein. Point mutation knockin cell lines enable a clear understanding of the contribution of the mutation to a phenotype.
Smart-CRISPR™ Point Mutation Cell Line Generation - Custom Stable Gene Editing Services
Homozygous delivery, As Fast as 6 weeks, As low as $6200
Point mutations, where specific genomic sites are replaced with foreign mutation sites through homologous recombination or homology-directed repair (HDR) pathways, are implemented to achieve stable expression of a specific phenotype within cells. The insertion, deletion, nonsense and sense mutations alter the amino acid sequence, thus changing its functions or properties of a given protein. Point mutation knockin cell lines enable a clear understanding of the contribution of the mutation to a phenotype.
However, the development of cell line research models comes with a myriad of challenges: from complications in obtaining knock-in positive clones and point mutation homozygotes, to problems with the cultured cells exhibiting poor health.
Smart-CRISPR™: Resolving the Challenges of Stable Point Mutation Cell Line Model Development
Compared to gene knockout (KO) cell lines, the experimental design plans for point mutation cell lines require consideration of various factors, such as the length of gene fragments and homologous recombination efficiency. Different cell lines can exhibit significant differences in editing and homologous recombination efficiency, making their development more challenging. This is especially true for many human-derived stem cell lines and induced pluripotent stem cells (iPSCs) used in current research to model complex human diseases.
After extensive testing and process optimization, Cyagen has developed the Smart-CRISPR™ Cell Gene Editing System, enabling more in-depth gene information analysis and more efficient gRNA design.
Advantages of the Smart-CRISPR™ Cell Gene Editing System
Our cutting-edge Smart-CRISPR™ Cell Gene Editing System enables us to provide accurate and efficient site-directed mutagenesis (SDM) for rapid custom point mutation cell development services. Implementing our proprietary optimized α-Donor system strategy significantly enhances knockin (KI) efficiency to develop point mutation cell lines with seamless integration and minimal off-target effects in as fast as 6 weeks.
- Our proprietary optimized α-donor system facilitates highly efficient homologous recombination, achieving HDR efficiency up to 87% for transfecting humanized Cas protein, gRNA, and donor components into target cells.
- Smart-CRISPR™ effortlessly enables various strategies like gene knockout (KO), knock-in (KI), and more, with gene editing efficiencies reaching as high as 90%.
- Point mutation project services include cell lines such as: A549, BEAS-2B, HCT116, HEK293, HeLa, iPSCs, and more.
- Homozygous clone delivery in as fast as 6 weeks
- Comprehensive CRO Platform for Downstream In Vivo Modeling
Point Mutation Cell Line Services：
Point Mutation Cell Line Service Workflow & Deliverables
Deliverable：Homozygous clone, QC report, Biweekly project updates
Research Applications of Point Mutation Cell Lines
Point mutation cell lines are used in various research applications to study the effects of specific genetic mutations on cellular processes and disease mechanisms. Some of the most common applications include:
1. Cancer Research: Point mutation cell lines are essential for understanding the role of specific mutations in cancer development, progression, and drug resistance. They help in evaluating potential targeted therapies and drug screening.
2. Drug Discovery and Development: These cell lines are used to test the efficacy and safety of new drugs and potential therapeutic compounds for a range of diseases, especially when mutations are known to be involved.
3. Genetic Disease Studies: Point mutation cell lines enable the investigation of genetic diseases caused by specific mutations, providing insights into disease mechanisms and potential treatment strategies.
4. Functional Genomics: Researchers use these cell lines to explore the functional consequences of specific mutations on cellular processes and gene expression, aiding in the identification of potential therapeutic targets.
5. Neurodegenerative Diseases: Researchers use point mutation cell lines to study mutations associated with neurodegenerative diseases like Alzheimer's and Parkinson's, allowing them to investigate disease mechanisms and develop potential treatments.
6. Rare Disease Research: For genetic-based rare disease research, point mutation cell lines help scientists model disease pathogenesis, screen for potential therapies, and gain a better understanding of the underlying biology.
Case Studies:
1. Point mutation rates in various cell types using Cyagen’s Optimized α-donor system
2. Homozygous positive rates in various cell types using Cyagen’s Optimized α-donor system
| Cell Line (Gene) | Cell pool （HDR） | Sequence Trace or Chromatogram | Homozygous positive rate |
| HEK 293 (Gene 6 ) | 80% | Wild-type sequence：TGTGAAAATTTACCGAGCAGA Point mutation sequence：TGTGAAAATTTACTGAGCAGA  |
50% |
| HCT-15 (Gene 7) | 57% | Wild-type sequence：CCTGGACAGAGAACATCCAAG Point mutation sequence：CCTGGACAAAGAACATTCAAG  |
41% |
| iPSCs (Gene 8) | 62% | Wild-type sequence：TGACTGCTGACAAAG Point mutation sequence：TGACTGCTGATAAAG  |
50% |
Why work with Cyagen?
Founded in 2006, Cyagen has successfully developed tens of thousands of gene editing projects across in vivo models (mice/rats) and in vitro models (cell lines/iPSCs/etc.). With over 1500 successful point mutation cell line cases and multiple published citations from scientific journals, we offer comprehensive services that span from cell gene expression regulation and functional validation to the construction of murine disease models and phenotype analysis, encompassing both in vivo mouse and rat research alongside in vitro cell studies.
- Guaranteed: 100% money back guarantee.
- Substantial experience: Over 18 years of experience with thousands of gene editing projects delivered.
- Optimized technology: By using optimized CRISPR-Pro technology, stable expression of foreign genes can be achieved.
- Customer citations: Over 6,300 publications citing our services and products.
Contact Us: Request a Quote
Request a quote now. Alternatively, you can always email animal-service@cyagen.com to inquire about our services or obtain a quote for your project.
Citation
1. Liu, Sheng et al. “The mechanism of STING autoinhibition and activation.” Molecular cell vol. 83,9 (2023): 1502-1518.e10. IF: 16.0 Q1
2. Hu, Shuwei et al. “Hepatocytic lipocalin-2 controls HDL metabolism and atherosclerosis via Nedd4-1-SR-BI axis in mice.” Developmental cell vol. 58,21 (2023): 2326-2337.e5. doi:10.1016/j.devcel.2023.09.007IF: 11.8 Q1
3. Qian, H., Ding, CH., Liu, F. et al. SRY-Box transcription factor 9 triggers YAP nuclear entry via direct interaction in tumors. Sig Transduct Target Ther 9, 96 (2024). https://doi.org/10.1038/s41392-024-01805-4IF: 39.3 Q1
4. Nan, D., Rao, C., Tang, Z. et al. Burkholderia pseudomallei BipD modulates host mitophagy to evade killing. Nat Commun 15, 4740 (2024). https://doi.org/10.1038/s41467-024-48824-xIF: 16.6 Q1
5. Latomanski, Eleanor A et al. “The Effector Cig57 Hijacks FCHO-Mediated Vesicular Trafficking to Facilitate Intracellular Replication of Coxiella burnetii.” PLoS pathogens vol. 12,12 e1006101. 21 Dec. 2016, doi:10.1371/journal.ppat.1006101IF: 6.7 Q1
6. Yang, Xue et al. “Excessive SOX8 reprograms energy and iron metabolism to prime hepatocellular carcinoma for ferroptosis.” Redox biology vol. 69 (2024): 103002. doi:10.1016/j.redox.2023.103002IF: 11.4 Q1
7. Zhou, Wenjing et al. “Glucosamine facilitates cardiac ischemic recovery via recruiting Ly6Clow monocytes in a STAT1 and O-GlcNAcylation-dependent fashion.” Clinical and translational medicine vol. 12,3 (2022): e762. doi:10.1002/ctm2.762IF: 10.6 Q1
8. Xie, Yunyi et al. “SHED-derived exosomes promote LPS-induced wound healing with less itching by stimulating macrophage autophagy.” Journal of nanobiotechnology vol. 20,1 239. 21 May. 2022, doi:10.1186/s12951-022-01446-1IF: 10.2 Q1
9. Wu, Yuhao et al. “Di-(2-ethylhexyl) phthalate exposure leads to ferroptosis via the HIF-1α/HO-1 signaling pathway in mouse testes.” Journal of hazardous materials vol. 426 (2022): 127807. doi:10.1016/j.jhazmat.2021.127807IF: 13.6 Q1
10. Zhao, Bin et al. “Periplaneta Americana extract inhibits osteoclastic differentiation in vitro.” Cell proliferation vol. 56,2 (2023): e13341. doi:10.1111/cpr.13341IF: 8.5 Q1
